فراوانی اینتگرون‌های کلاس I و II و ژن های مقاومت به آمینوگلیکوزیدها در جدایه های بالینی استافیلوکوکوس اورئوس در شمال ایران
محورهای موضوعی : Biotechnological Journal of Environmental Microorganismsمهسا آقایی 1 , لیلا اسدپور 2 , امیر آراسته 3
1 - گروه زیست شناسی، واحد رشت،دانشگاه آزاد اسلامی، رشت، ایران
2 - گروه زیست شناسی ، واحد رشت، دانشگاه آزاد اسلامی ، رشت ، ایران
3 - گروه زیست شناسی، واحد رشت ، دانشگاه آزاد اسلامی ، رشت ، ایران
کلید واژه: : استافیلوکوکوس اورئوس, آمینوگلیکوزیدها, اینتگرون, aac(6’)-Ie-aph(2”), aph(3’)-IIIa, ant(4’)-Ia,
چکیده مقاله :
استافیلوکوکوس اورئوس یک باکتری بیماریزای بیمارستانی است که می تواند طیف وسیعی از عفونت ها را ایجاد کند. آمینوگلیکوزیدها یکی از داروهای انتخابی در درمان سپتی سمی ناشی از این باکتری هستند. هدف از این مطالعه بررسی میزان مقاومت به آمینوگلیکوزیدها، تعیین فراوانی ژن‌های آنزیمی تغییر دهنده آمینوگلیکوزیدها و فراوانی اینتگرون‌های کلاس I و II در بین جدایه‌های بالینی استافیلوکوکوس اورئوس می‌باشد. در این مطالعه مقاومت ۲۰۰ جدایه استافیلوکوکوس اورئوس به آمینوگلیکوزیدها شامل جنتامایسین، کانامایسین، آمیکاسین و استرپتومایسین با روش انتشار از دیسک کربی-بوئر بررسی شد. فراوانی ژن‌های aac(6’)-Ie-aph (2”)، aph(3’)-IIIa و ant(4’)-Ia و اینتگرون‌های کلاس I و II در جدایه‌های مورد بررسی با روش PCR تعیین شد. از ۲۰۰ ایزوله، ۱۳۴ ایزوله (67%) به حداقل یک آمینوگلیکوزید مقاوم بودند. از این تعداد، فراوانی ژن های aac(6')-Ie-aph(2”)، aph(3')-IIIa و ant(4)- Ia به ترتیب ۰۷/۳۵، ۱/۲۹ و ۲۰ درصد بود. اینتگرون های کلاس I و II به ترتیب در ۶۶% و ۱۹% از جدایه ها شناسایی شدند تمامی جدایه های حامل اینتگرون کلاس I، مقاوم به آمینوگلیکوزید و از نظر حصور ژن های تغییر دهنده آمینوگلیکوزید مثبت بودند. نتایج نشان داد که در جدایه های بالینی استافیلوکوکوس اورئوس حامل اینتگرون های calss I و II مقاومت بالایی به آمینوگلیکوزیدها وجود دارد و فراوانی ژن های تغییر دهنده آمینوگلیکوزیدها بالاست.
Staphylococcus aureus is known as a hospital pathogenic bacterium that can cause a wide range of infections. Aminoglycosides are one of the drugs of choice in the treatment of septicemia caused by this bacterium. The aim of this study is to investigate the level of resistance to aminoglycosides, determine the frequency of aminoglycosides modifying enzyme genes and the frequency of class I and II integrons among clinical isolates of aminoglycosides resistant S. aureus. In this study, the resistance of 200 isolates of S. aureus to aminoglycosides including gentamycin, kanamycin, amikacin and streptomycin were investigated by Kirby-Boyer disc diffusion method. The frequency of aac(6’)-Ie-aph(2”), aph(3’)-IIIa and ant(4’)-Ia genes and and class 1 and 2 integrons in test isolates were determined by PCR. Out of 200 isolates, 134 isolates (67%) were resistant to at least one aminoglycoside. Of this number, the frequency of aac(6’)-Ie-aph(2”), aph(3’)-IIIa and ant(4’)-Ia genes were 35.07%, 29.1% and 20%, respectively. Class I and II Integrons were detected in respectively 66% and 19% of isolates. All of isolates carrying class I integron were aminoglycoside resistant and positive for aminoglycoside modifying genes. The results showed high resistance to aminoglycosides and high frequency of aminoglycoside modifying genes in clinical S. aureus isolates carrying calss I and II integrons
Alli O, Ogbolu D, Bamigboye K, Animasaun A, Oluremi A. Distribution of genes encoding aminoglycoside modifying enzymesamongst methicillin resistantandmethicillin sensitive Staphylococcus aureus isolates from Nigerian hospitals. Afr J Microbiol Res. 2015;9(5):318–25.
Arabestani, M. R., S. Rastiany, S. F. Mousavi, S. Ghafel and M. Y. Alikhani (2015). "Identification of toxic shock syndrom and exfoliative toxin genes of Staphylococcus aureus in carrier persons, resistant and susceptible methicillin." Tehran University Medical Journal 73(8): 554-560.
Ardic, N., B. Sareyyupoglu, M. Ozyurt, T. Haznedaroglu and U. Ilga (2006). "Investigation of aminoglycoside modifying enzyme genes in methicillin-resistant staphylococci." Microbiological research 161(1): 49-54
Choi, S. M., S. H. Kim, H. J. Kim, D. G. Lee, J. H. Choi, J. H. Yoo, J. H. Kang, W. S. Shin and M. W. Kang (2003). "Multiplex PCR for the detection of genes encoding aminoglycoside modifying enzymes and methicillin resistance among Staphylococcus species." Journal of Korean medical science 18(5): 631-636.
Didelot, X., A. S. Walker, T. E. Peto, D. W. Crook and D. J. Wilson (2016). "Within-host evolution of bacterial pathogens." Nature Reviews Microbiology 14(3): 150-162.
Fatholahzadeh, B., M. Emaneini, M. M. Feizabadi, H. Sedaghat, M. Aligholi, M. Taherikalani and F. Jabalameli (2009). "Characterisation of genes encoding aminoglycoside-modifying enzymes among meticillin-resistant Staphylococcus aureus isolated from two hospitals in Tehran, Iran." International journal of antimicrobial agents 33(3): 264-265.
Ferreira, A. M., K. B. Martins, V. R. d. Silva, A. L. Mondelli and M. d. L. R. d. S. d. Cunha (2017). "Correlation of phenotypic tests with the presence of the blaZ gene for detection of beta-lactamase." brazilian journal of microbiology 48: 159-166
Gade ND, Qazi MS. Recent trend of aminoglycoside resistance among Staphylococcus aureus isolates in tertiary care hospital. J Microbiol Antimicrob. 2014;6(6):94–6. doi: 10.5897/JMA2014.0315.
Goudarzi M, Seyedjavadi SS, Azad M, Goudarzi H, Azimi H. Distribution of spa types, integrons and associated gene cassettes in Staphylococcus aureus strains isolated from intensive care units of hospitals in Tehran, Iran. Archives of Clinical Infectious Diseases. 2016;11
Hall RM, editor Mobile gene cassettes and integrons: moving antibiotic resistance genes in gram‐negative bacteria. Ciba Foundation Symposium 207‐Antibiotic Resistance: Origins, Evolution, Selection and Spread: Antibiotic Resistance: Origins, Evolution, Selection and Spread: Ciba Foundation Symposium 207; 2007: Wiley Online Library
Hu Y, Liu A, Vaudrey J, Vaiciunaite B, Moigboi C, McTavish SM, et al. Combinations of beta-lactam or aminoglycoside antibiotics with plectasin are synergistic against methicillin-sensitive and methicillin-resistant Staphylococcus aureus. PLoS One. 2015;10(2) doi: 10.1371/journal.pone.0117664. [PubMed: 25692771].
Jana S, Deb J. Molecular understanding of aminoglycoside action and resistance. Applied microbiology and biotechnology. 2006;70(2):140-50
Mahdiyoun SM, Kazemian H, Ahanjan M, Houri H, Goudarzi M. Frequency of aminoglycoside-resistance genes in methicillin-resistant Staphylococcus aureus (MRSA) isolates from hospitalized
Moura A, Henriques I, Ribeiro R, Correia A. Prevalence and characterization of integrons from bacteria isolated from a slaughterhouse wastewater treatment plant. Journal of Antimicrobial Chemotherapy. 2007;60(6):1243-50
Nikaido H, Zgurskaya HI. AcrAB and related multidrug efflux pumps of Escherichia coli. J Mol Microbiol Biotechnol 2001; 3(2): 215-8.
Nihonyanagi, S., Y. Kanoh, K. Okada, T. Uozumi, Y. Kazuyama, T. Yamaguchi, N. Nakazaki, K. Sakurai, Y. Hirata and S. Munekata (2012). "Clinical usefulness of multiplex PCR lateral flow in MRSA detection: a novel, rapid genetic testing method." Inflammation 35(3): 927-934
Partridge SR, Kwong SM, Firth N, Jensen SO. Mobile genetic elements associated with antimicrobial resistance. Clinical microbiology reviews. 2018;31(4):10.1128/cmr. 00088-17.
Rahi, A., H. Kazemeini, S. Jafariaskari, A. Seif, S. Hosseini and F. S. Dehkordi (2020).
"Genotypic and phenotypic-based assessment of antibiotic resistance and profile of staphylococcal cassette chromosome mec in the methicillin-resistant Staphylococcus aureus recovered from raw milk." Infection and drug resistance 13: 273.
Soleimani N, Sattari M. A molecular study of aac(3)– IIa(aacC2) gene in aminoglycoside resistant Escherichia coli isolated from urine. Journal of Medical Science: Pathobiology. 2010; 13(3): 23-30.
Salasia SIO, Tato S, Sugiyono N, Ariyanti D, Prabawati F. Genotypic characterization of Staphylococcus aureus isolated from bovines, humans, and food in Indonesia. Journal of veterinary science. 2011;12(4):353.
Shmitz FJ, Fluit AC, Gondolf M, Beyrau R, Lindenlauf E, Verhoef J, et al. The prevalence of aminoglycoside resistance and corresponding resistance genes in clinical isolates of staphylococci from 19 European hospitals. J Antimicrob Chemother. 1999;4(3): 253-9
Straub JA, Hertel C, Hammes WP. A 23S rDNA-targeted polymerase chain reaction–based system for detection of Staphylococcus aureus in meat starter cultures and dairy products. Journal of food protection. 1999;62(10):1150-6
Vanhoof, R., C. Godard, J. Content, H. Nyssen and E. Hannecart-Pokorni (1994). "Detection by polymerase chain reaction of genes encoding aminoglycoside-modifying enzymes in methicillin-resistant Staphylococcus aureus isolates of epidemic phage types." Journal of medical microbiology 41(4): 282-290.
Yadegar A, Satri M, Mozafari N. Pervalence ant (4’)-Ia gene among nosocomial methicillin resistant Staphylococcus aureus by Multiplex-PCR. MJMS. 2010;1:59-68
Yahaghi E, Fooladi AAI, Amin M, Mirnejad R, Nezamzade R, Amani J. Detection of class I integrons in Staphyloacoccus aurous isolated from clinical samples. Iranian Red Crescent Medical Journal. 2014;16
Yang H, Chen S, White DG, Zhao S, McDermott P, Walker R, et al. Characterization of multiple-antimicrobial-resistant Escherichia coli isolates from diseased chickens and swine in China. Journal of clinical microbiology. 2004;42(8):3483-9
Yoo, J. I., J. W. Kim, G. S. Kang, H. S. Kim, J. S. Yoo and Y. S. Lee (2013). "Prevalence of amino acid changes in the yvqF, vraSR, graSR, and tcaRAB genes from vancomycin intermediate resistant Staphylococcus aureus." Journal of microbiology 51: 160-165.
Zhang Z, Wang J, Wang H, Zhang L, Shang W, Li Z, Song L, Li T, Cheng M, Zhang C, Zhao Q. Molecular Surveillance of MRSA in Raw Milk Provides Insight into MRSA Cross Species Evolution. Microbiology Spectrum. 2023 Jun 1:e00311-23
Zuo GY, Han ZQ, Hao XY, Han J, Li ZS, Wang GC. Synergy of aminoglycoside antibiotics by 3 benzylchroman derivatives from the chinese drug caesalpinia sappan against clinical methicillin-resistant staphylococcus aureus (MRSA). Phytomed. 2014;21(7):936-41.
Frequency of Class I and II Integrons and Aminoglycoside-Resistance Genes in Clinical Isolates of Staphylococcus aureus in northern Iran
Mahsa Aghaei, Leila Asadpour*, Amir Arasteh
Department of Biology, Rasht Branch, Islamic Azad University, Rasht, Iran
*Corresponding author: Leila Asadpour, E-mail: l.asadpour@yahoo.com, le.asadpour@iau.ac.ir
Abstract
Staphylococcus aureus is known as a hospital pathogenic bacterium that can cause a wide range of infections. Aminoglycosides are one of the drugs of choice in the treatment of septicemia caused by this bacterium. The aim of this study is to investigate the level of resistance to aminoglycosides, determine the frequency of aminoglycosides modifying enzyme genes and the frequency of class I and II integrons among clinical isolates of aminoglycosides resistant S. aureus. In this study, the resistance of 200 isolates of S. aureus to aminoglycosides including gentamycin, kanamycin, amikacin and streptomycin were investigated by Kirby-Boyer disc diffusion method. The frequency of aac(6’)-Ie-aph(2”), aph(3’)-IIIa and ant(4’)-Ia genes and and class 1 and 2 integrons in test isolates were determined by PCR. Out of 200 isolates, 134 isolates (67%) were resistant to at least one aminoglycoside. Of this number, the frequency of aac(6’)-Ie-aph(2”), aph(3’)-IIIa and ant(4’)-Ia genes were 35.07%, 29.1% and 20%, respectively. Class I and II Integrons were detected in respectively 66% and 19% of isolates. All of isolates carrying class I integron were aminoglycoside resistant and positive for aminoglycoside modifying genes. The results showed high resistance to aminoglycosides and high frequency of aminoglycoside modifying genes in clinical S. aureus isolates carrying calss I and II integrons.
Key words: S. aureus, aminoglycosides, integron, aac(6’)-Ie-aph(2”) , aph(3’)-IIIa , ant(4’)-Ia
Introduction
Staphylococcus aureus is the major cause of nosocomial infections in both developed and developing countries. This bacterium can cause various types of infection, including soft tissue infections, pneumonia, endocarditis, sepsis, pneumonia, catheter-related infections (Mahdiyoun et al., 2016, Hu 2015) .S. aureus has a broad spectrum of virulence agents that allow it to be resistant to a large group of antibiotics including aminoglycosides, and provoking the emergence of multidrug-resistant (MDR) isolates. Also because of its ability to adapt to host defense stress S. aureus is considered as a successful pathogen (Yoo et al., 2013, Walker et al., 2016).
Aminoglycosides are a group of antibacterial agents that are used to treat many bacterial infections, particularly those caused by staphylococci (Gade, 2014). Aminoglycosides exert antibacterial effects by targeting the bacterial ribosome and disrupt protein synthesis (Jana et al, 2006). The three mechanisms of resistance to aminoglycosides include: change in the ribosomal position of the drug, reduced permeability of the drug and the enzymatic deactivation of the drug which is the most common resistance mechanism of aminoglycoside antibiotics. These enzymes are classified into three main categories based on their modifying activity: aminoglycoside acetyl transferases (AACs), aminoglycoside phosphotransferases (APHs), and aminoglycoside nucleotidyltransferases (ANTs). These three enzymes are encoded by aac (6')-Ie/aph (2"), aph (3)-IIIa, and ant (4)-Ia genes, respectively (Alli O et al., 2015, Soleimani et al 2010, Nikaido et al 2001, Zuo et al 2014).
On the other hand, studies showed that several different mechanisms including mobile genetic elements consisting of plasmids, transposons and integrons play an important role in acquiring and spreading antibiotic resistance genes (Partridge et al, 2018). Integrons are one of the mobile genetic factors that are able to carry and spread antibiotic resistance genes among these bacteria, and their horizontal transfer among bacteria is one of the most important ways of spreading resistance genes and creating resistant strains. (Hall et al, 2007). The present study was aimed to investigate the level of resistance to aminoglycosides, determine the frequency of aminoglycosides modifying enzyme genes and the frequency of class I and II integrons among clinical isolates of S. aureus resistant to aminoglycosides.
Materials and Methods
Sampling and isolation of bacteria
In this cross- sectional study, clinical samples were collected from patients' blood, urine, and skin lesions in Gilan province, northern Iran during 2021. In total, 200 non-duplicate S. aureus isolates were included in this study and duplicate samples of patients were excluded. To isolate test bacteria, samples culture was performed on mannitol salt agar and blood agar (Merck, Germany). Coagulase, catalase and DNase production was investigated, and subsequently S. aureus isolates were identified by a pair of 23SrRNA specific primers as described previously (Salasia et al 2011, Straub,1999). S. aureus ATCC43300 strain has been used as a positive control.
Antimicrobial susceptibility testing
Aminoglycoside resistant isolates detected in phenotypic assay were screened for aminoglycoside resistance using Kirby-Bauer disc diffusion method according to the CLSI (2020) guideline. The disk of antibiotics (High Media-India), including gentamicin, kanamycin, streptomycin, and amikacin were used to determine the antibiotic sensitivity of S.aureus isolates.
Identifying aminoglycoside resistance genes
This research examined 3 aminoglycoside resistance encoding genes, including aac(6’)-Ie/aph(2”), ant(4’)-Ia, aph(3’)-IIIa in PCR reaction. For this purpose, the polymerase chain reaction (PCR) was carried out using gene-specific primers (Table 1) in a total volume of 25 μl; 0.5 μl dNTPS (10 μM), 5 μl enzyme buffer (10×), 3 μl reverse and forward primers (10 pM), 2 μl template DNA (2 μg), 0.5 μl Pfu enzyme (2.5 units) (Bioneer, South Korea), and 14 μL distilled water. The thermocycler thermal treatment consisted of initial denaturation step of 94 °C for 4 min, 30 cycle of 94 °C for 50 s, 60 °C for 45 s, 72 °C 60 s, and a final extension of 72 °C for 10 min. The PCR product was then electrophoresed on 1.5% agarose gel, which was examined via UV transilluminator.
Detection of class I and II integrons
All test isolates were screened for class I and II integrons in PCR reaction as described previously (Moura et al., 2007).
Table 1. Nucleotid sequences of primers used for PCR
Ref. | Annealing Tem. | Amplicon size (bp) | Primer Sequence (5'-3') | Gene |
|
|
| F:CCAAGAGCAATAAGGGCATACC | aac(6’)-Ie/aph(2” ) |
(Mahdiyoun et al 2016) | 45
| 222 | R:CACACTATCATAACCACTACCG |
|
F:AATCGGTAGAAGCCCAA | ||||
(Mahdiyoun et al 2016) | 47 | 135 | R:GCACCTGCCATTGCTA | ant(4’)-Ia |
F:CTGATCGAAAAATACCGCTGC | ||||
(Mahdiyoun et al 2016)
(Moura et al., 2007)
(Moura et al., 2007) | 51
55
50 | 269
280
233 | R:TCATACTCTTCCGAGCAAAGG | aph(3’)-IIIa
intI1
intI2 |
F: CCT CCC GCA CGA TGA TC R: TCC ACG CAT CGT CAG GC F: TTA TTG CTG GGA TTA GGC R: ACG GCT ACC CTC TGT TAT C | ||||
|
Results
Aminoglycoside resistance in test isolates
Out of 200 isolates, 134 isolates (67%) were resistant to at least one aminoglycoside. Among them resistance to gentamicin, amikacin, streptomycin and Kanamycin were detected in 44.15%, 59%, 89.55% and 50% respectively.
Frequency of aminoglycoside resistance genes
The frequency of aac(6’)-Ie-aph(2”), aph(3’)-IIIa and ant(4’)-Ia genes in phenotypic detected aminoglycoside resistant S. aureus isolates were 35.07%, 29.1% and 20%, respectively.
Figure 1. Agarose gel electrophoresis of of aac(6)-le-aph(2 ) gene PCR amplicons. Lanes 1-7: 369bp PCR amplicons of aac(6)-le-aph(2 ), Lane M:100bp DNA marker
Figure 2. Agarose gel electrophoresis of of aph(3)-llla gene PCR amplicons. Lanes 1-7: 523bp PCR amplicons of aph(3)-llla , Lane M:100bp DNA marker
Investigating the presence of intI and int II genes
Class I and II Integrons was detected in respectively 66% and 19% isolates. All of isolates carrying class I integrone were aminoglycoside resistant and positive for aminoglycoside modifying genes.
Figure 3. Agarose gel electrophoresis of IntI gene PCR amplicons. Lanes 1-9: 285bp PCR amplicons of IntI. Lane M:100bp DNA marker.
Figure 4. Agarose gel electrophoresis of IntII gene PCR amplicons. Lanes 1-22: 788bp PCR amplicons of IntII. Lane M:100bp DNA marker.
Discussion
In the present study, the prevalence of aminoglycoside resistance in S. aureus isolates was evaluated. Tested isolates showed the high level of resistance to aminoglycosides. Increase in frequency of antibiotic resistance gene such as gene encoding for resistance to aminoglycosides (aacA-D and aph), is a challenge for treatment of infections caused by S. aureus (Mahdiyoun et al., 2016). Several mechanisms including the presence of genetic mobile factors encoding drug resistance genes, such as plasmids and transposons, help in the spread of antibiotic resistance among these bacteria. In addition, the role of integrons in the spread of antibiotic resistance has been proven in many bacteria, including Staphylococcus aureus (Yang, 2004). In the present study, the presence of intI and int II genes was detected in 66% and 19% of the isolates, respectively. All of isolates carrying class I integrone were aminoglycoside resistant and positive for aminoglycoside modifying genes.
During a descriptive study conducted by Guderzi et al., on 80 S. aureus strains isolated from patients hospitalized in ICU departments in five hospitals in Tehran, class 1 and 2 were detected in 56.3% and 18.7%, respectively (Goudarzi M, 2016). In another study conducted by Yahaghi et al., on 200 strains of S. aureus in 2013, only 1% of the strains (two isolates) contained class I integron (Yahaghi, 2014).
In the present study, more than 67% of S.aureus isolates showed aminoglycoside resistant phenotype and the genes aac(6’)-Ie/aph(2” ), aph(3’)-IIIa and ant(4’)-Ia encoding for aminoglycoside modifying enzyme were detected in 35.07%, 29.1% and 20%, isolates respectively. In accordance with present finding Mahdiyoun et al., showed that the aac (6’)/aph (2’) gene is the most prevalent gene (77%) encoding AME enzymes among clinical MRSA isolates in Sari and Tehran. These researchers also reported high frequency of aph (3’)-IIIa (68.4%) and ant (4’)-Ia (70.1%) genes among MRSA isolates from hospitalized patients (Mahdiyoun et al., 2016). Also, A Systematic Review and Meta-analysis, introduced aac(6’)-Ie/aph(2” ), as the most common AMEs gene in Gram positive cocci including enterococci and MRSA in Iran (Arabestani et al., 2015).
During the last two decades, the results of various studies in other countries showed that the aac(6')/aph(2'') gene is the most abundant gene encoding aminoglycoside-modifying enzymes in MRSA clinical isolates (Vanhoof et al., 1994, Choi et al., 2003, Sareyyupoglu et al., 2006, Fatholahzadeh et al., 2009). In the present study, the prevalence of ant (4')-Ia gene was 20%. According to our studies, the frequency of the aac(6')-Ie/aph(2") gene in the investigated strains was 35.07%, while the findings from Turkey and Korea show that in clinical strains, the aac(6′)/aph(2′′)-Ia gene is the most abundant gene (66% and 65%) among genes encoding aminoglycoside-modifying enzymes (AME) ( Sareyyupoglu et al., 2006, Nihonyanagi et al., 2012). Also, high frequency of aminoglycoside resistance genes including ant (6´)-Ia (79.59%) and aph(3´)-III (73.47%) has been reported in a study conducted by Zhang Z et al., (2023).
Conclusion
The results showed high resistance to aminoglycosides and high frequency of aminoglycoside modifying genes in clinical S. aureus isolates carrying calss I integron. Rapid identification of these strains and treatment of related disease are required to prevent the spread of these bacteria.
References
Alli O, Ogbolu D, Bamigboye K, Animasaun A, Oluremi A. Distribution of genes encoding aminoglycoside modifying enzymesamongst methicillin resistantandmethicillin sensitive Staphylococcus aureus isolates from Nigerian hospitals. Afr J Microbiol Res. 2015;9(5):318–25.
Arabestani, M. R., S. Rastiany, S. F. Mousavi, S. Ghafel and M. Y. Alikhani (2015). "Identification of toxic shock syndrom and exfoliative toxin genes of Staphylococcus aureus in carrier persons, resistant and susceptible methicillin." Tehran University Medical Journal 73(8): 554-560.
Ardic, N., B. Sareyyupoglu, M. Ozyurt, T. Haznedaroglu and U. Ilga (2006). "Investigation of aminoglycoside modifying enzyme genes in methicillin-resistant staphylococci." Microbiological research 161(1): 49-54
Choi, S. M., S. H. Kim, H. J. Kim, D. G. Lee, J. H. Choi, J. H. Yoo, J. H. Kang, W. S. Shin and M. W. Kang (2003). "Multiplex PCR for the detection of genes encoding aminoglycoside modifying enzymes and methicillin resistance among Staphylococcus species." Journal of Korean medical science 18(5): 631-636.
Didelot, X., A. S. Walker, T. E. Peto, D. W. Crook and D. J. Wilson (2016). "Within-host evolution of bacterial pathogens." Nature Reviews Microbiology 14(3): 150-162.
Fatholahzadeh, B., M. Emaneini, M. M. Feizabadi, H. Sedaghat, M. Aligholi, M. Taherikalani and F. Jabalameli (2009). "Characterisation of genes encoding aminoglycoside-modifying enzymes among meticillin-resistant Staphylococcus aureus isolated from two hospitals in Tehran, Iran." International journal of antimicrobial agents 33(3): 264-265.
Ferreira, A. M., K. B. Martins, V. R. d. Silva, A. L. Mondelli and M. d. L. R. d. S. d. Cunha (2017). "Correlation of phenotypic tests with the presence of the blaZ gene for detection of beta-lactamase." brazilian journal of microbiology 48: 159-166
Gade ND, Qazi MS. Recent trend of aminoglycoside resistance among Staphylococcus aureus isolates in tertiary care hospital. J Microbiol Antimicrob. 2014;6(6):94–6. doi: 10.5897/JMA2014.0315.
Goudarzi M, Seyedjavadi SS, Azad M, Goudarzi H, Azimi H. Distribution of spa types, integrons and associated gene cassettes in Staphylococcus aureus strains isolated from intensive care units of hospitals in Tehran, Iran. Archives of Clinical Infectious Diseases. 2016;11
Hall RM, editor Mobile gene cassettes and integrons: moving antibiotic resistance genes in gram‐negative bacteria. Ciba Foundation Symposium 207‐Antibiotic Resistance: Origins, Evolution, Selection and Spread: Antibiotic Resistance: Origins, Evolution, Selection and Spread: Ciba Foundation Symposium 207; 2007: Wiley Online Library
Hu Y, Liu A, Vaudrey J, Vaiciunaite B, Moigboi C, McTavish SM, et al. Combinations of beta-lactam or aminoglycoside antibiotics with plectasin are synergistic against methicillin-sensitive and methicillin-resistant Staphylococcus aureus. PLoS One. 2015;10(2) doi: 10.1371/journal.pone.0117664. [PubMed: 25692771].
Jana S, Deb J. Molecular understanding of aminoglycoside action and resistance. Applied microbiology and biotechnology. 2006;70(2):140-50
Mahdiyoun SM, Kazemian H, Ahanjan M, Houri H, Goudarzi M. Frequency of aminoglycoside-resistance genes in methicillin-resistant Staphylococcus aureus (MRSA) isolates from hospitalized
Moura A, Henriques I, Ribeiro R, Correia A. Prevalence and characterization of integrons from bacteria isolated from a slaughterhouse wastewater treatment plant. Journal of Antimicrobial Chemotherapy. 2007;60(6):1243-50
Nikaido H, Zgurskaya HI. AcrAB and related multidrug efflux pumps of Escherichia coli. J Mol Microbiol Biotechnol 2001; 3(2): 215-8.
Nihonyanagi, S., Y. Kanoh, K. Okada, T. Uozumi, Y. Kazuyama, T. Yamaguchi, N. Nakazaki, K. Sakurai, Y. Hirata and S. Munekata (2012). "Clinical usefulness of multiplex PCR lateral flow in MRSA detection: a novel, rapid genetic testing method." Inflammation 35(3): 927-934
Partridge SR, Kwong SM, Firth N, Jensen SO. Mobile genetic elements associated with antimicrobial resistance. Clinical microbiology reviews. 2018;31(4):10.1128/cmr. 00088-17.
Rahi, A., H. Kazemeini, S. Jafariaskari, A. Seif, S. Hosseini and F. S. Dehkordi (2020).
"Genotypic and phenotypic-based assessment of antibiotic resistance and profile of staphylococcal cassette chromosome mec in the methicillin-resistant Staphylococcus aureus recovered from raw milk." Infection and drug resistance 13: 273.
Soleimani N, Sattari M. A molecular study of aac(3)– IIa(aacC2) gene in aminoglycoside resistant Escherichia coli isolated from urine. Journal of Medical Science: Pathobiology. 2010; 13(3): 23-30.
Salasia SIO, Tato S, Sugiyono N, Ariyanti D, Prabawati F. Genotypic characterization of Staphylococcus aureus isolated from bovines, humans, and food in Indonesia. Journal of veterinary science. 2011;12(4):353.
Shmitz FJ, Fluit AC, Gondolf M, Beyrau R, Lindenlauf E, Verhoef J, et al. The prevalence of aminoglycoside resistance and corresponding resistance genes in clinical isolates of staphylococci from 19 European hospitals. J Antimicrob Chemother. 1999;4(3): 253-9
Straub JA, Hertel C, Hammes WP. A 23S rDNA-targeted polymerase chain reaction–based system for detection of Staphylococcus aureus in meat starter cultures and dairy products. Journal of food protection. 1999;62(10):1150-6
Vanhoof, R., C. Godard, J. Content, H. Nyssen and E. Hannecart-Pokorni (1994). "Detection by polymerase chain reaction of genes encoding aminoglycoside-modifying enzymes in methicillin-resistant Staphylococcus aureus isolates of epidemic phage types." Journal of medical microbiology 41(4): 282-290.
Yadegar A, Satri M, Mozafari N. Pervalence ant (4’)-Ia gene among nosocomial methicillin resistant Staphylococcus aureus by Multiplex-PCR. MJMS. 2010;1:59-68
Yahaghi E, Fooladi AAI, Amin M, Mirnejad R, Nezamzade R, Amani J. Detection of class I integrons in Staphyloacoccus aurous isolated from clinical samples. Iranian Red Crescent Medical Journal. 2014;16
Yang H, Chen S, White DG, Zhao S, McDermott P, Walker R, et al. Characterization of multiple-antimicrobial-resistant Escherichia coli isolates from diseased chickens and swine in China. Journal of clinical microbiology. 2004;42(8):3483-9
Yoo, J. I., J. W. Kim, G. S. Kang, H. S. Kim, J. S. Yoo and Y. S. Lee (2013). "Prevalence of amino acid changes in the yvqF, vraSR, graSR, and tcaRAB genes from vancomycin intermediate resistant Staphylococcus aureus." Journal of microbiology 51: 160-165.
Zhang Z, Wang J, Wang H, Zhang L, Shang W, Li Z, Song L, Li T, Cheng M, Zhang C, Zhao Q. Molecular Surveillance of MRSA in Raw Milk Provides Insight into MRSA Cross Species Evolution. Microbiology Spectrum. 2023 Jun 1:e00311-23
Zuo GY, Han ZQ, Hao XY, Han J, Li ZS, Wang GC. Synergy of aminoglycoside antibiotics by 3 benzylchroman derivatives from the chinese drug caesalpinia sappan against clinical methicillin-resistant staphylococcus aureus (MRSA). Phytomed. 2014;21(7):936-41.
